plotTopMotifsSequence,MotifEnrichmentResults-method {PWMEnrich} | R Documentation |
Plot the top N enrichment motifs in a single sequence
obj |
a MotifEnrichmentResults object |
seq.id |
either the sequence number or sequence name |
n |
the number of top ranked motifs to plot |
bg |
if to use background corrected P-values to do the ranking (if available) |
id |
if to show PWM IDs instead of target TF names |
... |
other parameters passed to
|
if(require("PWMEnrich.Dmelanogaster.background")){ ### # load the pre-compiled lognormal background data(PWMLogn.dm3.MotifDb.Dmel) # scan two sequences for motif enrichment sequences = list(DNAString("GAAGTATCAAGTGACCAGTAAGTCCCAGATGA"), DNAString("AGGTAGATAGAACAGTAGGCAATGAAGCCGATG")) res = motifEnrichment(sequences, PWMLogn.dm3.MotifDb.Dmel) # plot the top 4 motifs in a 2x2 grid plotTopMotifsSequence(res, 1, 4) # plot top 3 motifs in a single row plotTopMotifsSequence(res, 1, 3, row=1, cols=3) }