Introduction to RBPEqBind

Overview

RBPEqBind simulates competitive binding of multiple RNA-binding proteins (RBPs) to RNA sequences using an equilibrium binding model. This package provides tools for:

  • Loading RBP affinity models from k-mer tables
  • Simulating competitive binding at equilibrium
  • Visualizing binding profiles and competition patterns
  • Exporting results to various formats including SummarizedExperiment

Introduction

Background

RBPEqBind implements a mathematical simulation framework for RNA-RBP interactions based on equilibrium binding kinetics. The simulation follows two key principles:

  1. Simultaneous competition: All RBPs are introduced simultaneously, ensuring equal chances of interaction with the RNA.
  2. Independent binding sites: Each RNA binding site and its interactions with RBPs are treated as independent events, allowing calculation of equilibrium concentrations for each binding site.

Motivation

Competitive binding among multiple RNA-binding proteins (RBPs) is a fundamental regulator of post-transcriptional gene expression. Understanding how multiple RBPs compete for overlapping binding sites is critical for interpreting transcriptome-wide binding data (such as CLIP-seq) and functional genomics studies. RBPEqBind provides a mathematical simulation framework to model competitive RBP binding kinetics on transcript sequences, allowing researchers to explore how RBP binding landscapes are altered by relative protein abundances, RNA concentration, and binding affinity distributions.

Mathematical Model

For an RNA sequence of length \(l\) interacting with \(N\) RBPs, there exist \(l - (k-1)\) possible k-mer binding sites. For each binding site \(R\) on the RNA, the kinetic reaction scheme is:

\[R + P_i \rightleftharpoons P_iR\]

At equilibrium, the dissociation constant is defined as:

\[K_{D,i} = \frac{[R_{eq}][P_{i,eq}]}{[P_iR]}\]

Given the initial concentrations of RBPs (\([P_{0,i}]\)) and RNA (\([R_0]\)), the equilibrium concentration of each RNA-RBP complex can be determined by solving the system of equations with the constraint:

\[[R_0] \geq [R_{eq}] \geq 0\]

From the equilibrium concentrations, binding probability at each unique motif site (\(p_{site}\)) is calculated as \([P_iR] / [R_{0,e}]\), where \([R_{0,e}] = n \times [R_0]\) is the effective initial RNA concentration accounting for the motif multiplicity \(n\) in the transcript sequence. Per-position probability (\(p_{pos}\)) is then obtained by averaging overlapping \(p_{site}\) values across all \(k\)-mer windows covering each position.

For RBP enrichment analysis: - With a single active RBP, fold-change (_occupancy_fc and _density_fc) represents enrichment relative to a uniform distribution across the transcript. - With multiple active RBPs, fold-change represents the competitive ratio of self-occupancy relative to the sum of all other active competing RBPs at that position.

Reference

For a detailed description of the mathematical model and its biological applications, please refer to:

Yi S, Singh SS, Ye X, Krishna R, Kothwela V, Jankowsky E, Luna JM. (2025). Inherent Specificity and Mutational Sensitivity as Quantitative Metrics for RBP Binding. bioRxiv. https://www.biorxiv.org/content/10.1101/2025.03.28.646018v4

Installation

To install RBPEqBind, start R and use the BiocManager package:

if (!requireNamespace("BiocManager", quietly = TRUE))
    install.packages("BiocManager")

BiocManager::install("RBPEqBind")

For the development version from GitHub, you can use devtools or pak:

# install.packages("devtools")
devtools::install_github("S00NYI/RBPEqBind")

Setup

library(RBPEqBind)
library(data.table)
library(ggplot2)

Data Loading

Loading RBP Models

RBP affinity models are loaded from CSV files containing k-mer motifs and scores (enrichment or affinity values). The CSV file requires a column of sequence motifs and score columns for each RBP.

The RBP-RNA affinity scores can be derived from:

  • RNA Bind-n-Seq (RBNS)
  • RNACompete
  • Other similar RBP target enrichment experiments

For generating motif enrichment scores from CLIP experiments, please refer to the companion R package RBPSpecificity (in development).

# Load raw models from package sample data
model_file <- system.file("extdata", "model_RBP.csv", package = "RBPEqBind")
raw_models <- loadModel(model_file)

# View available RBPs
names(raw_models)
#> [1] "HH" "HL" "LH" "LL"

The included four model RBPs (HH, HL, LH, LL) are designed to bind the 5-mer poly-U motif (UUUUU) with highest affinity, but with varying binding specificity and affinity distributions. For details on how these model RBP scores were generated, please refer to the manuscript referenced above.

Visualizing Raw Models

The viewModel() function can be used to inspect the score distributions of raw models before affinity conversion:

viewModel(raw_models, rbp = c("HH", "HL", "LH", "LL"), bins = 100, alpha = 0.4)
Raw score distributions for model RBPs

Raw score distributions for model RBPs

Setting Affinity Ranges

The included RBP models have enrichment scores normalized to a 0-to-1 scale. For binding simulation, each RBP may have different minimum and maximum affinity ranges, which are set using the setModel() function:

# High affinity (H) = high Ka -> low Kd
# Low affinity (L) = low Ka -> high Kd
max_affinities <- c(
  "HH" = 100, "HL" = 100,  # Ka_max = 100 -> Kd_min = 0.01 nM
  "LH" = 10,  "LL" = 10    # Ka_max = 10  -> Kd_min = 0.1 nM
)

min_affinities <- c(
  "HH" = 0.001, "HL" = 0.001,  # Ka_min = 0.001 -> Kd_max = 1000 nM
  "LH" = 0.001, "LL" = 0.001
)

rbp_models <- setModel(raw_models, 
                        max_affinity = max_affinities, 
                        min_affinity = min_affinities)

The viewModel() function can be used again to inspect the converted affinity (Ka) or dissociation constant (Kd) distributions:

viewModel(rbp_models, rbp = c("HH", "HL", "LH", "LL"), metric = "Ka", 
           bins = 100, alpha = 0.4)
Ka distributions for all RBPs

Ka distributions for all RBPs

To compare specific RBPs, pass only the desired subset:

viewModel(rbp_models, rbp = c("HH", "LL"), metric = "Ka", bins = 100, alpha = 0.5)
Comparing HH vs LL affinity distributions

Comparing HH vs LL affinity distributions

RNA-RBP Binding Simulations

Given the initial concentrations of RBPs and RNA, along with association constants (or dissociation constants) per motif per RBP, RBPEqBind calculates several metrics for each nucleotide position:

Metric Description
occupancy Binding probability (0-1)
density Normalized binding (sum = 1)
density_fc Fold-change over expectation
occupancy_fc Fold-change over mean occupancy

For single RBP simulations (only one RBP with concentration > 0):

  • density_fc = density × L (enrichment over uniform distribution)
  • occupancy_fc = occupancy / mean(occupancy)

For multiple active RBPs:

  • density_fc = self_density / sum(other_densities)
  • occupancy_fc = self_occupancy / sum(other_occupancies)

This vignette covers four simulation scenarios of increasing complexity:

  1. Scenario 1: Single sequence, fixed concentrations
  2. Scenario 2: Single sequence, concentration grid sweep
  3. Scenario 3: FASTA file, fixed concentrations
  4. Scenario 4: FASTA file, concentration grid sweep

Scenario 1: RBPs Binding to a Single RNA Target at Fixed Concentrations

Generating or Loading RNA Sequence

Users can provide their own sequence or use the built-in generateRNA() function to create randomized RNA sequences:

# Generate a random 100-nt RNA sequence
random_seq <- generateRNA(100)
cat("Generated sequence:", substr(random_seq, 1, 50), "...\n")
#> Generated sequence: GCUGACUGGGACCACGCUUUCCGGGGUUGGACAUGUUAGGUGAAGUUUAA ...

# Or use a specific reference sequence
seq <- "UAGCGGUGCGAUUGGCCCGUGGACCGCGUUUUUGCACUCAUCGUUUCGCACUAAGUACAUAUAGUUGCGACAAAGCCGCUUAUGAGUUGGGGGUAUAUUC"

Running the Simulation

Set initial concentrations of RBPs and target RNA, then run the simulation:

# Define concentrations (nM) - competitive binding of all 4 RBPs
prot_concs <- c("HH" = 100, "HL" = 100, "LH" = 100, "LL" = 100)
rna_conc <- 10.0  # nM

# Detect k-mer size from models
k_size <- nchar(rbp_models$HH$motif[1])

# Run simulation
res <- simulateBinding(
  sequence = seq,
  rbp_models = rbp_models,
  protein_concs = prot_concs,
  rna_conc = rna_conc,
  k = k_size
)

# Add transcript column for visualization
res$transcript <- "Custom RNA"

head(res)
#>      pos     nt         HH        HL        LH        LL  HH_density
#>    <int> <char>      <num>     <num>     <num>     <num>       <num>
#> 1:     1      U 0.07129708 0.1167119 0.3740217 0.4372868 0.006983791
#> 2:     2      A 0.05867352 0.1329368 0.3441924 0.4633364 0.005747270
#> 3:     3      G 0.04830287 0.1269083 0.3580165 0.4659452 0.004731430
#> 4:     4      C 0.04433490 0.1227539 0.3663078 0.4657982 0.004342753
#> 5:     5      G 0.04896784 0.1274139 0.3609860 0.4618369 0.004796566
#> 6:     6      G 0.04653250 0.1242896 0.3641747 0.4642060 0.004558016
#>     HL_density  LH_density LL_density HH_density_fc HH_occupancy_fc
#>          <num>       <num>      <num>         <num>           <num>
#> 1: 0.007527902 0.010734056 0.01110460     0.2378145      0.07682706
#> 2: 0.008574407 0.009877986 0.01176611     0.1901904      0.06238773
#> 3: 0.008185566 0.010274724 0.01183236     0.1561907      0.05079860
#> 4: 0.007917610 0.010512674 0.01182862     0.1435198      0.04643079
#> 5: 0.008218178 0.010359946 0.01172803     0.1582704      0.05153225
#> 6: 0.008016664 0.010451457 0.01178819     0.1506468      0.04884428
#>    HL_density_fc HL_occupancy_fc LH_density_fc LH_occupancy_fc LL_density_fc
#>            <num>           <num>         <num>           <num>         <num>
#> 1:     0.2611820       0.1322356     0.4190324       0.5981516     0.4398600
#> 2:     0.3130332       0.1534709     0.3786441       0.5255273     0.4862096
#> 3:     0.3049933       0.1454929     0.4151512       0.5583919     0.5101975
#> 4:     0.2967170       0.1400596     0.4364100       0.5787885     0.5194135
#> 5:     0.3056842       0.1461519     0.4187059       0.5656150     0.5017405
#> 6:     0.2991553       0.1420594     0.4289912       0.5734781     0.5119482
#>    LL_occupancy_fc transcript
#>              <num>     <char>
#> 1:       0.7780479 Custom RNA
#> 2:       0.8647518 Custom RNA
#> 3:       0.8738204 Custom RNA
#> 4:       0.8732681 Custom RNA
#> 5:       0.8594428 Custom RNA
#> 6:       0.8676799 Custom RNA

Visualization

Each metric calculated using simulateBinding() can be visualized with built-in plotting functions.

Per-Position Binding Profile

The plotBinding() function displays binding metrics across positions:

Note: The visualizations below show a zoomed-in view from positions 20-60. The xlim parameter can be removed to show the entire sequence, or adjusted to view a specific segment of the target RNA.

plotBinding(res, rbp = c("HH", "HL", "LH", "LL"), metric = "density_fc", 
             transcript = "Custom RNA", xlim = c(20, 60))
Raw density_fc (positions 20-60)

Raw density_fc (positions 20-60)

For smoother visualization, apply a k-mer sliding window average:

plotBinding(res, rbp = c("HH", "HL", "LH", "LL"), metric = "density_fc", 
             transcript = "Custom RNA", window = 5, xlim = c(20, 60))
Density FC with 5-mer smoothing window (positions 20-60)

Density FC with 5-mer smoothing window (positions 20-60)

Heatmap Visualization

The plotHeatmap() function displays binding for multiple RBPs simultaneously:

plotHeatmap(res, transcript = "Custom RNA", xlim = c(20, 60), 
             xaxis_type = "both", metric = "occupancy_fc")
Heatmap of occupancy_fc (zoomed region)

Heatmap of occupancy_fc (zoomed region)

Exporting Results

Simulation results can be exported using the built-in exportResults() function in JSON or CSV format:

# Export to JSON
tmp_json <- tempfile(fileext = ".json")
exportResults(res, output_file = tmp_json, format = "json")

# Export to CSV
tmp_csv <- tempfile(fileext = ".csv")
exportResults(res, output_file = tmp_csv, format = "csv")

# Clean up
unlink(tmp_json)
unlink(tmp_csv)

Results can also be converted to SummarizedExperiment format:

se <- makeSE(res, rbp_models = rbp_models)
se
#> class: SummarizedExperiment 
#> dim: 100 4 
#> metadata(0):
#> assays(4): occupancy density density_fc occupancy_fc
#> rownames: NULL
#> rowData names(3): pos nt transcript
#> colnames(4): HH HL LH LL
#> colData names(3): RBP Kd_min Kd_max

Scenario 2: RBP Binding with Varying Concentration Grid

To run simulations across multiple combinations of RBP and RNA concentrations, use the simulateGrid() function. RBPEqBind uses the future.apply framework for parallel processing, running sequentially by default and automatically utilizing parallel workers when the user configures a future::plan:

# Optional: enable parallel processing across 2 workers
library(future)
plan(multisession, workers = 2)

Running Grid Simulation

# Define concentration grids
prot_grid <- list(
  HH = c(10, 100), 
  HL = c(10, 100),
  LH = c(10, 100),
  LL = c(10, 100)
)
rna_grid <- c(10)

res_grid <- simulateGrid(
  sequence = seq,
  rbp_models = rbp_models,
  protein_conc_grid = prot_grid,
  rna_conc_grid = rna_grid,
  k = k_size
)

Visualization

Grid sweep results can be visualized for specific concentration combinations using the same plotting functions:

# Filter to specific concentration combination
plotBinding(
  results = res_grid,
  rbp = c("HH", "HL", "LH", "LL"),
  rna_conc = 10,
  protein_conc = c(HH=10, HL=10, LH=100, LL=100),
  metric = "density"
)

Competition Grid Plot

The plotGrid() function focuses on changes in binding for one RBP across different target RNA and competitor RBP concentrations:

# First run a 2-RBP simulation for cleaner visualization
rbp_models_2rbp <- rbp_models[c("HH", "LL")]

res_grid_2rbp <- simulateGrid(
  sequence = seq,
  rbp_models = rbp_models_2rbp,
  protein_conc_grid = list(HH = c(10, 50), LL = c(10, 50)),
  rna_conc_grid = c(10),
  k = k_size
)

plotGrid(
  results = res_grid_2rbp,
  rbp1 = "HH",
  rbp2 = "LL",
  rbp1_concs = c(10, 50),
  roi_range = c(29, 33),
  metric = "density"
)

Grid sweep results can also be exported in JSON/CSV or SummarizedExperiment format.

Scenario 3: RBPs Binding to Multiple Target RNAs

To simulate RBP binding to multiple RNA sequences (e.g., transcript sequences from bioMart), RBPEqBind provides functions to load FASTA files directly. Note that binding simulation is performed on a sequence-by-sequence basis, not simultaneously on all RNA sequences in the FASTA file.

# Load sample FASTA from package
fasta_file <- system.file("extdata", "test_transcripts.fa", package = "RBPEqBind")

res_fasta <- simulateBindingFasta(
  fasta_file = fasta_file,
  rbp_models = rbp_models,
  protein_concs = c(HH = 100, HL = 100, LH = 100, LL = 100),
  rna_conc = 10,
  k = 5
)
head(res_fasta)
#>      pos     nt        HH        HL         LH        LL   HH_density
#>    <int> <char>     <num>     <num>      <num>     <num>        <num>
#> 1:     1      U 0.1319377 0.2172656 0.07975064 0.5701071 0.0003151770
#> 2:     2      C 0.1482320 0.2344256 0.15800529 0.4585148 0.0003541014
#> 3:     3      A 0.1550461 0.2172857 0.18999212 0.4368384 0.0003703789
#> 4:     4      A 0.1428079 0.2068544 0.21404929 0.4354432 0.0003411440
#> 5:     5      C 0.1281987 0.2137216 0.22752862 0.4297183 0.0003062450
#> 6:     6      C 0.1152156 0.2109461 0.27011203 0.4028967 0.0002752306
#>      HL_density   LH_density   LL_density HH_density_fc HH_occupancy_fc
#>           <num>        <num>        <num>         <num>           <num>
#> 1: 0.0004226189 9.702996e-05 0.0005887760     0.2843468       0.1521557
#> 2: 0.0004559980 1.922398e-04 0.0004735295     0.3156638       0.1741968
#> 3: 0.0004226581 2.311571e-04 0.0004511433     0.3351971       0.1836785
#> 4: 0.0004023672 2.604267e-04 0.0004497024     0.3066473       0.1667641
#> 5: 0.0004157252 2.768266e-04 0.0004437900     0.2695008       0.1471909
#> 6: 0.0004103265 3.286364e-04 0.0004160901     0.2382839       0.1303410
#>    HL_density_fc HL_occupancy_fc LH_density_fc LH_occupancy_fc LL_density_fc
#>            <num>           <num>         <num>           <num>         <num>
#> 1:     0.4222039       0.2779059    0.07314338      0.08675049     0.7052680
#> 2:     0.4471135       0.3065380    0.14976277      0.18783935     0.4724244
#> 3:     0.4015070       0.2779028    0.18579071      0.23479871     0.4404861
#> 4:     0.3827428       0.2610807    0.21825655      0.27263762     0.4479384
#> 5:     0.4048503       0.2721024    0.23746442      0.29486427     0.4443246
#> 6:     0.4022978       0.2676220    0.29831365      0.37049436     0.4102670
#>    LL_occupancy_fc
#>              <num>
#> 1:       1.3290636
#> 2:       0.8480604
#> 3:       0.7768448
#> 4:       0.7724574
#> 5:       0.7546213
#> 6:       0.6756909
#>                                                                             transcript
#>                                                                                 <char>
#> 1: PTBP2_hg19 range=chr1:97269727-97272451 5'pad=0 3'pad=0 strand=+ repeatMasking=none
#> 2: PTBP2_hg19 range=chr1:97269727-97272451 5'pad=0 3'pad=0 strand=+ repeatMasking=none
#> 3: PTBP2_hg19 range=chr1:97269727-97272451 5'pad=0 3'pad=0 strand=+ repeatMasking=none
#> 4: PTBP2_hg19 range=chr1:97269727-97272451 5'pad=0 3'pad=0 strand=+ repeatMasking=none
#> 5: PTBP2_hg19 range=chr1:97269727-97272451 5'pad=0 3'pad=0 strand=+ repeatMasking=none
#> 6: PTBP2_hg19 range=chr1:97269727-97272451 5'pad=0 3'pad=0 strand=+ repeatMasking=none

Visualization and result export are performed the same way as in Scenario 1.

Scenario 4: RBPs Binding to Multiple Target RNAs Across Different Concentrations

RBPEqBind also supports concentration grid sweeps across sequences in a FASTA file:

fasta_file <- system.file("extdata", "test_transcripts.fa", package = "RBPEqBind")

res_grid_fasta <- simulateGridFasta(
  fasta_file = fasta_file,
  rbp_models = rbp_models,
  protein_conc_grid = list(
    HH = c(10, 100),
    HL = c(10, 100),
    LH = c(10, 100),
    LL = c(10, 100)
  ),
  rna_conc_grid = c(10),
  k = 5
)
head(res_grid_fasta)
#>      pos     nt        HH        HL        LH        LL   HH_density
#>    <int> <char>     <num>     <num>     <num>     <num>        <num>
#> 1:     1      U 0.1641753 0.2460096 0.1056294 0.4703919 0.0004374202
#> 2:     2      C 0.1806942 0.2488883 0.1745693 0.3821979 0.0004814321
#> 3:     3      A 0.1879711 0.2368540 0.2014866 0.3589431 0.0005008203
#> 4:     4      A 0.1727699 0.2264808 0.2225873 0.3641544 0.0004603191
#> 5:     5      C 0.1557077 0.2316158 0.2347091 0.3646240 0.0004148594
#> 6:     6      C 0.1457214 0.2304463 0.2711244 0.3381027 0.0003882525
#>      HL_density   LH_density   LL_density HH_density_fc HH_occupancy_fc
#>           <num>        <num>        <num>         <num>           <num>
#> 1: 0.0005991885 0.0002123307 0.0009017772     0.2553091       0.1997192
#> 2: 0.0006061998 0.0003509102 0.0007327026     0.2849026       0.2242822
#> 3: 0.0005768887 0.0004050178 0.0006881213     0.2998874       0.2357644
#> 4: 0.0005516236 0.0004474334 0.0006981117     0.2712276       0.2124509
#> 5: 0.0005641304 0.0004718000 0.0006990120     0.2391200       0.1873854
#> 6: 0.0005612820 0.0005450001 0.0006481687     0.2212957       0.1735453
#>    HL_density_fc HL_occupancy_fc LH_density_fc LH_occupancy_fc LL_density_fc
#>            <num>           <num>         <num>           <num>         <num>
#> 1:     0.3861925       0.3323571     0.1095399       0.1199547     0.7220344
#> 2:     0.3873370       0.3374933     0.1927724       0.2150450     0.5093369
#> 3:     0.3619218       0.3164801     0.2293640       0.2570742     0.4640918
#> 4:     0.3435058       0.2981927     0.2616486       0.2915717     0.4783631
#> 5:     0.3557676       0.3067593     0.2811677       0.3121350     0.4818148
#> 6:     0.3549225       0.3052477     0.3411148       0.3795823     0.4336926
#>    LL_occupancy_fc rna_conc Conc_HH Conc_HL Conc_LH Conc_LL
#>              <num>    <num>   <num>   <num>   <num>   <num>
#> 1:       0.9119404       10      10      10      10      10
#> 2:       0.6326191       10      10      10      10      10
#> 3:       0.5731062       10      10      10      10      10
#> 4:       0.5856097       10      10      10      10      10
#> 5:       0.5861815       10      10      10      10      10
#> 6:       0.5223341       10      10      10      10      10
#>                                                                             transcript
#>                                                                                 <char>
#> 1: PTBP2_hg19 range=chr1:97269727-97272451 5'pad=0 3'pad=0 strand=+ repeatMasking=none
#> 2: PTBP2_hg19 range=chr1:97269727-97272451 5'pad=0 3'pad=0 strand=+ repeatMasking=none
#> 3: PTBP2_hg19 range=chr1:97269727-97272451 5'pad=0 3'pad=0 strand=+ repeatMasking=none
#> 4: PTBP2_hg19 range=chr1:97269727-97272451 5'pad=0 3'pad=0 strand=+ repeatMasking=none
#> 5: PTBP2_hg19 range=chr1:97269727-97272451 5'pad=0 3'pad=0 strand=+ repeatMasking=none
#> 6: PTBP2_hg19 range=chr1:97269727-97272451 5'pad=0 3'pad=0 strand=+ repeatMasking=none

Visualization and export functions work the same as in Scenario 2.

Session Info

sessionInfo()
#> R version 4.6.1 (2026-06-24)
#> Platform: x86_64-pc-linux-gnu
#> Running under: Ubuntu 26.04.1 LTS
#> 
#> Matrix products: default
#> BLAS:   /usr/lib/x86_64-linux-gnu/openblas-pthread/libblas.so.3 
#> LAPACK: /usr/lib/x86_64-linux-gnu/openblas-pthread/libopenblasp-r0.3.32.so;  LAPACK version 3.12.0
#> 
#> locale:
#>  [1] LC_CTYPE=en_US.UTF-8       LC_NUMERIC=C              
#>  [3] LC_TIME=en_US.UTF-8        LC_COLLATE=en_US.UTF-8    
#>  [5] LC_MONETARY=en_US.UTF-8    LC_MESSAGES=en_US.UTF-8   
#>  [7] LC_PAPER=en_US.UTF-8       LC_NAME=C                 
#>  [9] LC_ADDRESS=C               LC_TELEPHONE=C            
#> [11] LC_MEASUREMENT=en_US.UTF-8 LC_IDENTIFICATION=C       
#> 
#> time zone: Etc/UTC
#> tzcode source: system (glibc)
#> 
#> attached base packages:
#> [1] stats4    stats     graphics  grDevices utils     datasets  methods  
#> [8] base     
#> 
#> other attached packages:
#>  [1] Biostrings_2.81.9    Seqinfo_1.3.2        XVector_0.53.0      
#>  [4] IRanges_2.47.5       S4Vectors_0.51.10    BiocGenerics_0.59.12
#>  [7] generics_0.1.4       future_1.75.0        ggplot2_4.0.3       
#> [10] data.table_1.18.6.1  RBPEqBind_0.99.4     BiocStyle_2.41.0    
#> 
#> loaded via a namespace (and not attached):
#>  [1] SummarizedExperiment_1.43.0 gtable_0.3.6               
#>  [3] rjson_0.2.23                xfun_0.61                  
#>  [5] bslib_0.12.0                Biobase_2.73.2             
#>  [7] lattice_0.23-1              vctrs_0.7.3                
#>  [9] tools_4.6.1                 bitops_1.1-0               
#> [11] curl_8.0.0                  parallel_4.6.1             
#> [13] BiocBaseUtils_1.15.1        Matrix_1.7-6               
#> [15] RColorBrewer_1.1-3          S7_0.2.2                   
#> [17] cigarillo_1.3.1             lifecycle_1.0.5            
#> [19] farver_2.1.2                compiler_4.6.1             
#> [21] Rsamtools_2.29.0            codetools_0.2-20           
#> [23] htmltools_0.5.9             sys_3.4.3                  
#> [25] buildtools_1.0.0            sass_0.4.10                
#> [27] RCurl_1.98-1.20             yaml_2.3.12                
#> [29] crayon_1.5.3                jquerylib_0.1.4            
#> [31] BiocParallel_1.47.0         DelayedArray_0.39.7        
#> [33] cachem_1.1.0                abind_1.4-8                
#> [35] parallelly_1.48.0           digest_0.6.39              
#> [37] restfulr_0.0.17             listenv_1.0.0              
#> [39] labeling_0.4.3              maketools_1.3.2            
#> [41] fastmap_1.2.0               grid_4.6.1                 
#> [43] cli_3.6.6                   SparseArray_1.13.3         
#> [45] S4Arrays_1.13.1             XML_3.99-0.24              
#> [47] future.apply_1.20.2         withr_3.0.3                
#> [49] scales_1.4.0                rmarkdown_2.32             
#> [51] httr_1.4.9                  matrixStats_1.5.0          
#> [53] globals_0.19.1              otel_0.2.0                 
#> [55] evaluate_1.0.5              knitr_1.52                 
#> [57] GenomicRanges_1.65.4        BiocIO_1.23.3              
#> [59] viridisLite_0.4.3           rtracklayer_1.73.0         
#> [61] rlang_1.3.0                 glue_1.8.1                 
#> [63] BiocManager_1.30.27         jsonlite_2.0.0             
#> [65] R6_2.6.1                    MatrixGenerics_1.25.0      
#> [67] GenomicAlignments_1.49.2