Contents

1 12-mer dissociation rates

McGeary, Lin et al. (2019) used RNA bind-n-seq (RBNS) to empirically determine the affinities (i.e. dissoiation rates) of selected miRNAs towards random 12-nucleotide sequences (termed 12-mers). As expected, bound sequences typically exhibited complementarity to the miRNA seed region (positions 2-8 from the miRNA’s 5’ end), but the study also revealed non-canonical bindings and the importance of flanking di-nucleotides. Based on these data, the authors developed a model which predicted 12-mer dissociation rates (KD) based on the miRNA sequence. ScanMiR encodes a compressed version of these prediction in the form of a KdModel object.

The 12-mer is defined as the 8 nucleotides opposite the miRNA’s extended seed region plus flanking dinucleotides on either side:

2 KdModels

The KdModel class contains the information concerning the sequence (12-mer) affinity of a given miRNA, and is meant to compress and make easily manipulable the dissociation constants (Kd) predictions from McGeary, Lin et al. (2019).

We can take a look at the example KdModel:

library(scanMiR)
data(SampleKdModel)
SampleKdModel
## A `KdModel` for hsa-miR-155-5p (Conserved across mammals)
##   Sequence: UUAAUGCUAAUCGUGAUAGGGGUU
##   Canonical target seed: AGCATTA(A)

In addition to the information necessary to predict the binding affinity to any given 12-mer sequence, the model contains, minimally, the name and sequence of the miRNA. Since the KdModel class extends the list class, any further information can be stored:

SampleKdModel$myVariable <- "test"

An overview of the binding affinities can be obtained with the following plot:

plotKdModel(SampleKdModel, what="seeds")

The plot gives the -log(Kd) values of the top 7-mers (including both canonical and non-canonical sites), with or without the final “A” vis-à-vis the first miRNA nucleotide.

To predict the dissociation constant (and binding type, if any) of a given 12-mer sequence, you can use the assignKdType function:

assignKdType("ACGTACGTACGT", SampleKdModel)
##            type log_kd
## 1 non-canonical      0
# or using multiple sequences:
assignKdType(c("CTAGCATTAAGT","ACGTACGTACGT"), SampleKdModel)
##            type log_kd
## 1          8mer  -5129
## 2 non-canonical      0

The log_kd column contains log(Kd) values multiplied by 1000 and stored as an integer (which is more economical when dealing with millions of sites). In the example above, -5129 means -5.129, or a dissociation constant of 0.0059225. The smaller the values, the stronger the relative affinity.

2.1 KdModelLists

A KdModelList object is simply a collection of KdModel objects. We can build one in the following way:

# we create a copy of the KdModel, and give it a different name:
mod2 <- SampleKdModel
mod2$name <- "dummy-miRNA"
kml <- KdModelList(SampleKdModel, mod2)
kml
## An object of class "KdModelList"
## [[1]]
## A `KdModel` for hsa-miR-155-5p (Conserved across mammals)
##   Sequence: UUAAUGCUAAUCGUGAUAGGGGUU
##   Canonical target seed: AGCATTA(A)
## [[2]]
## A `KdModel` for dummy-miRNA (Conserved across mammals)
##   Sequence: UUAAUGCUAAUCGUGAUAGGGGUU
##   Canonical target seed: AGCATTA(A)
summary(kml)
## A `KdModelList` object containing binding affinity models from 2 miRNAs.
## 
##               Low-confidence             Poorly conserved 
##                            0                            0 
##     Conserved across mammals Conserved across vertebrates 
##                            2                            0

Beyond operations typically performed on a list (e.g. subsetting), some specific slots of the respective KdModels can be accessed, for example:

conservation(kml)
##           hsa-miR-155-5p              dummy-miRNA 
## Conserved across mammals Conserved across mammals 
## 4 Levels: Low-confidence Poorly conserved ... Conserved across vertebrates

3 Creating a KdModel object

KdModel objects are meant to be created from a table assigning a log_kd values to 12-mer target sequences, as produced by the CNN from McGeary, Lin et al. (2019). For the purpose of example, we create such a dummy table:

kd <- dummyKdData()
head(kd)
##         X12mer log_kd
## 1 AAAGCAAAAAAA -0.428
## 2 CAAGCACAAACA -0.404
## 3 GAAGCAGAAAGA -0.153
## 4 TAAGCATAAATA -1.375
## 5 ACAGCAACAAAC -0.448
## 6 CCAGCACCAACC -0.274

A KdModel object can then be created with:

mod3 <- getKdModel(kd=kd, mirseq="TTAATGCTAATCGTGATAGGGGTT", name = "my-miRNA")

Alternatively, the kd argument can also be the path to the output file of the CNN (and if mirseq and name are in the table, they can be omitted).

4 Common KdModel collections

The scanMiRData package contains KdModel collections corresponding to all human, mouse and rat mirbase miRNAs.

5 Under the hood

When calling getKdModel, the dissociation constants are stored as an lightweight overfitted linear model, with base KDs coefficients (stored as integers in object$mer8) for each 1024 partially-matching 8-mers (i.e. at least 4 consecutive matching nucleotides) to which are added 8-mer-specific coefficients (stored in object$fl) that are multiplied with a flanking score generated by the flanking di-nucleotides. The flanking score is calculated based on the di-nucleotide effects experimentally measured by McGeary, Lin et al. (2019). To save space, the actual 8-mer sequences are not stored but generated when needed in a deterministic fashion. The 8-mers can be obtained, in the right order, with the getSeed8mers function.



Session info

## R version 4.6.1 Patched (2026-06-24 r90190)
## Platform: x86_64-apple-darwin20
## Running under: macOS Ventura 13.7.8
## 
## Matrix products: default
## BLAS:   /Library/Frameworks/R.framework/Versions/4.6-x86_64/Resources/lib/libRblas.0.dylib 
## LAPACK: /Library/Frameworks/R.framework/Versions/4.6-x86_64/Resources/lib/libRlapack.dylib;  LAPACK version 3.12.1
## 
## locale:
## [1] C/en_US.UTF-8/en_US.UTF-8/C/en_US.UTF-8/en_US.UTF-8
## 
## time zone: America/New_York
## tzcode source: internal
## 
## attached base packages:
## [1] stats     graphics  grDevices utils     datasets  methods   base     
## 
## other attached packages:
## [1] scanMiR_1.19.3   BiocStyle_2.41.0
## 
## loaded via a namespace (and not attached):
##  [1] sass_0.4.10          generics_0.1.4       stringi_1.8.9       
##  [4] digest_0.6.39        magrittr_2.0.5       evaluate_1.0.5      
##  [7] grid_4.6.1           RColorBrewer_1.1-3   bookdown_0.48       
## [10] fastmap_1.2.0        jsonlite_2.0.0       BiocManager_1.30.27 
## [13] scales_1.4.0         Biostrings_2.81.9    codetools_0.2-20    
## [16] jquerylib_0.1.4      cli_3.6.6            rlang_1.3.0         
## [19] crayon_1.5.3         XVector_0.53.0       cowplot_1.2.0       
## [22] withr_3.0.3          cachem_1.1.0         yaml_2.3.12         
## [25] otel_0.2.0           tools_4.6.1          parallel_4.6.1      
## [28] BiocParallel_1.47.0  seqLogo_1.79.0       dplyr_1.2.1         
## [31] ggplot2_4.0.3        BiocGenerics_0.59.12 vctrs_0.7.3         
## [34] R6_2.6.1             stats4_4.6.1         lifecycle_1.0.5     
## [37] pwalign_1.9.1        Seqinfo_1.3.2        S4Vectors_0.51.10   
## [40] IRanges_2.47.5       pkgconfig_2.0.3      pillar_1.11.1       
## [43] bslib_0.12.0         gtable_0.3.6         glue_1.8.1          
## [46] data.table_1.18.6.1  xfun_0.61            tibble_3.3.1        
## [49] GenomicRanges_1.65.4 tidyselect_1.2.1     knitr_1.52          
## [52] dichromat_2.0-1      farver_2.1.2         htmltools_0.5.9     
## [55] labeling_0.4.3       rmarkdown_2.32       compiler_4.6.1      
## [58] S7_0.2.2