The ShortRead package provides functionality for working with FASTQ files from high throughput sequence analysis. The package also contains functions for legacy (single-end, ungapped) aligned reads; for working with BAM files, please see the Rsamtools, GenomicRanges, GenomicAlignments and related packages.
Sample FASTQ data are derived from ArrayExpress record E-MTAB-1147. Paired-end FASTQ files were retrieved and then sampled to 20,000 records with
Functionality is summarized in Table @ref(tab:table).
Input FASTQ files are large so processing involves
iteration in ‘chunks’ using FastqStreamer
strm <- FastqStreamer("a.fastq.gz")
repeat {
fq <- yield(strm)
if (length(fq) == 0)
break
## process chunk
}or drawing a random sample from the file
The default size for both streams and samples is 1M records; this
volume of data fits easily into memory. Use countFastq to
get a quick and memory-efficient count of the number of records and
nucleotides in a file
| Input | |
|---|---|
FastqStreamer |
Iterate through FASTQ files in chunks |
FastqSampler |
Draw random samples from FASTQ files |
readFastq |
Read an entire FASTQ file into memory |
writeFastq |
Write FASTQ objects to a connection (file) |
countFastq |
Quickly count FASTQ records in files |
| Sequence and quality summary | |
|---|---|
alphabetFrequency |
Nucleotide or quality score use per read |
alphabetByCycle |
Nucleotide or quality score use by cycle |
alphabetScore |
Whole-read quality summary |
encoding |
Character / ‘phred’ score mapping |
| Quality assessment | |
|---|---|
qa |
Visit FASTQ files to collect QA statistics |
report |
Generate a quality assessment report |
| Filtering and trimming | |
|---|---|
srFilter |
Pre-defined and bespoke filters |
trimTails, etc. |
Trim low-quality nucleotides |
narrow |
Remove leading / trailing nucleotides |
tables |
Summarize read occurrence |
srduplicated, etc. |
Identify duplicate reads |
filterFastq |
Filter reads from one file to another |
fl <- system.file(package="ShortRead", "extdata", "E-MTAB-1147",
"ERR127302_1_subset.fastq.gz")
countFastq(fl)
## records nucleotides scores
## ERR127302_1_subset.fastq.gz 20000 1440000 1440000Small FASTQ files can be read into memory in their entirety using
readFastq; we do this for our sample data
The result of data input is an instance of class
ShortReadQ (Table @ref(tab:table2)). This class contains
reads, their quality scores, and optionally the id of the read.
| DNAStringSet | (Biostrings) Short read sequences |
| FastqQuality, etc. | Quality encodings |
| ShortReadQ | Reads, quality scores, and ids |
fq
## class: ShortReadQ
## length: 20000 reads; width: 72 cycles
fq[1:5]
## class: ShortReadQ
## length: 5 reads; width: 72 cycles
head(sread(fq), 3)
## DNAStringSet object of length 3:
## width seq
## [1] 72 GTCTGCTGTATCTGTGTCGGCTGTCTCGCGGGAC...GTCAATGAAGGCCTGGAATGTCACTACCCCCAG
## [2] 72 CTAGGGCAATCTTTGCAGCAATGAATGCCAATGG...CAGTGGCTTTTGAGGCCAGAGCAGACCTTCGGG
## [3] 72 TGGGCTGTTCCTTCTCACTGTGGCCTGACTAAAA...TGGCATTAAGAAAGAGTCACGTTTCCCAAGTCT
head(quality(fq), 3)
## class: FastqQuality
## quality:
## BStringSet object of length 3:
## width seq
## [1] 72 HHHHHHHHHHHHHHHHHHHHEBDBB?B:BBGG<D...ABFEFBDBD@DDECEE3>:?;@@@>?=BAB?##
## [2] 72 IIIIHIIIGIIIIIIIHIIIIEGBGHIIIIHGII...IIIHIIIHIIIIIGIIIEGIIGBGE@DDGGGIG
## [3] 72 GGHBHGBGGGHHHHDHHHHHHHHHFGHHHHHHHH...HHHHHHHHGHFHHHHHHHHHHHHHH8AGDGGG>The reads are represented as DNAStringSet instances, and can be manipulated with the rich tools defined in the Biostrings package. The quality scores are represented by a class that represents the quality encoding inferred from the file; the encoding in use can be discovered with
encoding(quality(fq))
## ! " # $ % & ' ( ) * + , - . / 0 1 2 3 4 5 6 7 8 9 :
## 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25
## ; < = > ? @ A B C D E F G H I J K L M N O P Q R S T
## 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51
## U V W X Y Z [ \\ ] ^ _ ` a b c d e f g h i j k l m n
## 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77
## o p q r s t u v w x y z { | } ~
## 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93The primary source of documentation for these classes is
?ShortReadQ and ?QualityScore.
FASTQ files are often used for basic quality assessment, often to augment the purely technical QA that might be provided by the sequencing center with QA relevant to overall experimental design. A QA report is generated by creating a vector of paths to FASTQ files
collecting statistics over the files
and creating and viewing a report
By default, the report is based on a sample of 1M reads.
These QA facilities are easily augmented by writing custom functions
for reads sampled from files, or by exploiting the elements of the
object returned from qa(), e.g., for an analysis of
ArrayExpress experiment E-MTAB-1147:
qaSummary
## class: FastqQA(10)
## QA elements (access with qa[["elt"]]):
## readCounts: data.frame(16 3)
## baseCalls: data.frame(16 5)
## readQualityScore: data.frame(8192 4)
## baseQuality: data.frame(1504 3)
## alignQuality: data.frame(16 3)
## frequentSequences: data.frame(800 4)
## sequenceDistribution: data.frame(1953 4)
## perCycle: list(2)
## baseCall: data.frame(5681 4)
## quality: data.frame(44246 5)
## perTile: list(2)
## readCounts: data.frame(0 4)
## medianReadQualityScore: data.frame(0 4)
## adapterContamination: data.frame(16 1)For instance, the count of reads in each lane is summarized in the
readCounts element, and can be displayed as
head(qaSummary[["readCounts"]])
## read filter aligned
## ERR127302_1.fastq.gz 29741852 NA NA
## ERR127302_2.fastq.gz 29741852 NA NA
## ERR127303_1.fastq.gz 32665567 NA NA
## ERR127303_2.fastq.gz 32665567 NA NA
## ERR127304_1.fastq.gz 31876181 NA NA
## ERR127304_2.fastq.gz 31876181 NA NA
head(qaSummary[["baseCalls"]])
## A C G T N
## ERR127302_1.fastq.gz 16439860 19641395 19547421 16335620 35704
## ERR127302_2.fastq.gz 16238041 20020655 19608896 16060661 71747
## ERR127303_1.fastq.gz 16826258 19204659 19448727 16507994 12362
## ERR127303_2.fastq.gz 16426991 19822132 19374419 16324978 51480
## ERR127304_1.fastq.gz 16279217 19740457 19879137 16089405 11784
## ERR127304_2.fastq.gz 15984998 20297064 19812474 15853510 51954The readCounts element contains a data frame with 1 row
and 3 columns (these dimensions are indicated in the parenthetical
annotation of readCounts in the output of
qaSummary). The rows represent different lanes. The columns
indicated the number of reads, the number of reads surviving the Solexa
filtering criteria, and the number of reads aligned to the reference
genome for the lane. The baseCalls element summarizes the
base calls in the unfiltered reads.
The functions that produce the report tables and graphics are internal to the package. They can be accessed by calling ShortRead:::functionName where functionName is one of the functions listed below, organized by report section.
It is straightforward to create filters to eliminate reads or to trim reads based on diverse characteristics. The basic structure is to open a FASTQ file, iterate through chunks of the file, performing filtering or trimming steps, and appending the filtered data to a new file.
myFilterAndTrim <-
function(fl, destination=sprintf("%s_subset", fl))
{
## open input stream
stream <- open(FastqStreamer(fl))
on.exit(close(stream))
repeat {
## input chunk
fq <- yield(stream)
if (length(fq) == 0)
break
## trim and filter, e.g., reads cannot contain 'N'...
fq <- fq[nFilter()(fq)] # see ?srFilter for pre-defined filters
## trim as soon as 2 of 5 nucleotides has quality encoding less
## than "4" (phred score 20)
fq <- trimTailw(fq, 2, "4", 2)
## drop reads that are less than 36nt
fq <- fq[width(fq) >= 36]
## append to destination
writeFastq(fq, destination, "a")
}
}This is memory efficient and flexible. Care must be taken to coordinate pairs of FASTQ files representing paired-end reads, to preserve order.
ShortRead
provides a variety of methods to read data into R, in addition
to readAligned.
readXStringColumnsreadXStringColumns reads a column of DNA or other
sequence-like data. For instance, the Solexa files
s_N_export.txt contain lines with the following
information:
## location of file
exptPath <- system.file("extdata", package="ShortRead")
sp <- SolexaPath(exptPath)
pattern <- "s_2_export.txt"
fl <- file.path(analysisPath(sp), pattern)
strsplit(readLines(fl, n=1), "\t")
## [[1]]
## [1] "HWI-EAS88" "3"
## [3] "2" "1"
## [5] "451" "945"
## [7] "" ""
## [9] "CCAGAGCCCCCCGCTCACTCCTGAACCAGTCTCTC" "YQMIMIMMLMMIGIGMFICMFFFIMMHIIHAAGAH"
## [11] "NM" ""
## [13] "" ""
## [15] "" ""
## [17] "" ""
## [19] "" ""
## [21] "" "N"
length(readLines(fl))
## [1] 1000Column 9 is the read, and column 10 the ASCII-encoded Solexa Fastq quality score; there are 1000 lines (i.e., 1000 reads) in this sample file.
Suppose the task is to read column 9 as a DNAStringSet and
column 10 as a BStringSet. DNAStringSet is a class
that contains IUPAC-encoded DNA strings (IUPAC code allows for
nucleotide ambiguity); BStringSet is a class that contains any
character with ASCII code 0 through 255. Both of these classes are
defined in the Biostrings
package. readXStringColumns allows us to read in columns of
text as these classes.
Important arguments for readXStringColumns are the
dirPath in which to look for files, the
pattern of files to parse, and the colClasses
of the columns to be parsed. The dirPath and
pattern arguments are like list.files.
colClasses is like the corresponding argument to
read.table: it is a list specifying the class
of each column to be read, or NULL if the column is to be
ignored. In our case, there are 21 columns, and we would like to read in
columns 9 and 10. Hence
colClasses <- rep(list(NULL), 21)
colClasses[9:10] <- c("DNAString", "BString")
names(colClasses)[9:10] <- c("read", "quality")We use the class of the type of sequence (e.g., DNAString or
BString), rather than the class of the set that we will create
( e.g., DNAStringSet or BStringSet). Applying names to
colClasses is not required, but makes subsequent
manipulation easier. We are now ready to read our file
cols <- readXStringColumns(analysisPath(sp), pattern, colClasses)
cols
## $read
## DNAStringSet object of length 1000:
## width seq
## [1] 35 CCAGAGCCCCCCGCTCACTCCTGAACCAGTCTCTC
## [2] 35 AGCCTCCCTCTTTCTGAATATACGGCAGAGCTGTT
## [3] 35 ACCAAAAACACCACATACACGAGCAACACACGTAC
## [4] 35 AATCGGAAGAGCTCGTATGCCGGCTTCTGCTTGGA
## [5] 35 AAAGATAAACTCTAGGCCACCTCCTCCTTCTTCTA
## ... ... ...
## [996] 35 GTGGCAGCGGTGAGGCGGCGGGGGGGGGTTGTTTG
## [997] 35 GTCGGAGGTCAGCAAGCTGTAGTCGGTGTAAAGCT
## [998] 35 GTCATAAATTGGACAGTGTGGCTCCAGTATTCTCA
## [999] 35 ATCTACATTAAGGTCAATTACAATGATAAATAAAA
## [1000] 35 TTCTCAGCCATTCAGTATTCCTCAGGTGAAAATTC
##
## $quality
## BStringSet object of length 1000:
## width seq
## [1] 35 YQMIMIMMLMMIGIGMFICMFFFIMMHIIHAAGAH
## [2] 35 ZXZUYXZQYYXUZXYZYYZZXXZZIMFHXQSUPPO
## [3] 35 LGDHLILLLLLLLIGFLLALDIFDILLHFIAECAE
## [4] 35 JJYYIYVSYYYYYYYYSDYYWVUYYNNVSVQQELQ
## [5] 35 LLLILIIIDLLHLLLLLLLLLLLALLLLHLLLLEL
## ... ... ...
## [996] 35 ZZZZZZZYZZYUYZYUYZKYUDUZIYYODJGUGAA
## [997] 35 ZZZZZZZZZZZZZZZZZZYZZYXXZYSSXXUUHHQ
## [998] 35 ZZZZZZZZZZZZZZZYZZZZYZZZZYZZXZUUUUS
## [999] 35 ZZZZZZZZZZZYXZYZYZZYZYZZXKZSYXUUNUN
## [1000] 35 ZZZZZZZZZZZZZZYZZZZZZZZYYSYSZXUUUUUThe file has been parsed, and appropriate data objects were created.
A feature of readXStringColumns and other input
functions in the ShortRead
package is that all files matching pattern in the specified
dirPath will be read into a single object. This provides a
convenient way to, for instance, parse all tiles in a Solexa lane into a
single DNAStringSet object.
There are several advantages to reading columns as XStringSet objects. These are more compact than the corresponding character representation:
They are also created much more quickly. And the DNAStringSet and related classes are used extensively in ShortRead, Biostrings, BSgenome and other packages relevant to short-read technology.
Short reads can be sorted using srsort, or the
permutation required to bring the short read into lexicographic order
can be determined using srorder. These functions are
different from sort and order because the
result is independent of the locale, and they operate quickly on
DNAStringSet and BStringSet objects.
The function srduplicated identifies duplicate reads.
This function returns a logical vector, similar to
duplicated. The negation of the result from
srduplicated is useful to create a collection of unique
reads. An experimental scenario where this might be useful is when the
sample preparation involved PCR. In this case, replicate reads may be
due to artifacts of sample preparation, rather than differential
representation of sequence in the sample prior to PCR.
The tables function summarizes read occurrences, for
instance,
tbls <- tables(fq)
names(tbls)
## [1] "top" "distribution"
tbls$top[1:5]
## CTATTCTCTACAAACCACAAAGACATTGGAACACTATACCTATTATTCGGCGCATGAGCTGGAGTCCTAGGC
## 7
## GTTTGGTCTAGGGTGTAGCCTGAGAATAGGGGAAATCAGTGAATGAAGCCTCCTATGATGGCAAATACAGCT
## 7
## CGATAACGTTGTAGATGTGGTCGTTACCTAGAAGGTTGCCTGGCTGGCCCAGCTCGGCTCGAATAAGGAGGC
## 6
## CTAGCATTTACCATCTCACTTCTAGGAATACTAGTATATCGCTCACACCTCATATCCTCCCTACTATGCCTA
## 6
## CACGAGCATATTTCACCTCCGCTACCATAATCATCGCTATCCCCACCGGCGTCAAAGTATTTAGCTGACTCG
## 5
head(tbls$distribution)
## nOccurrences nReads
## 1 1 19291
## 2 2 247
## 3 3 34
## 4 4 18
## 5 5 3
## 6 6 2The top component returned by tables is a
list tallying the most commonly occurring sequences in the short reads.
Knowledgeable readers will recognize the top-occurring read as a close
match to one of the manufacturer adapters.
The distribution component returned by
tables is a data frame that summarizes how many reads
(e.g., 19291) are represented exactly 1 times.
Facilities exist for finding reads that are near matches to specific
sequences, e.g., manufacturer adapter or primer sequences.
srdistance reports the edit distance between each read and
a reference sequence. srdistance is implemented to work
efficiently for reference sequences whose length is of the same order as
the reads themselves (10’s to 100’s of bases). To find reads close to
the most common read in the example above, one might say
dist <- srdistance(sread(fq), names(tbls$top)[1])[[1]]
table(dist)[1:10]
## dist
## 0 4 6 10 14 18 20 21 31 32
## 7 1 3 1 3 1 4 1 3 11‘Near’ matches can be filtered, e.g.,
A different strategy can be used to tally or eliminate reads that
consist predominantly of a single nucleotide.
alphabetFrequency calculates the frequency of each
nucleotide (in DNA strings) or letter (for other string sets) in each
read. Thus one could identify and eliminate reads with more than 30
adenine nucleotides with
alphabetFrequency, which simply counts nucleotides, is
much faster than srdistance, which performs full pairwise
alignment of each read to the subject.
Users wanting to use R for whole-genome alignments or more
flexible pairwise alignment are encouraged to investigate the Biostrings
and pwalign
packages, especially the PDict class and
matchPDict and pairwiseAlignment
functions.
The ShortRead package contains functions and classes to support early file formats and ungapped alignments. Help pages are flagged as ‘legacy’; versions of ShortRead prior to 1.21 (Bioconductor version 2.13) contains a vignette illustrating common workflows with these file formats.
sessionInfo()
## R version 4.5.3 (2026-03-11)
## Platform: x86_64-pc-linux-gnu
## Running under: Ubuntu 24.04.4 LTS
##
## Matrix products: default
## BLAS: /usr/lib/x86_64-linux-gnu/openblas-pthread/libblas.so.3
## LAPACK: /usr/lib/x86_64-linux-gnu/openblas-pthread/libopenblasp-r0.3.26.so; LAPACK version 3.12.0
##
## locale:
## [1] LC_CTYPE=en_US.UTF-8 LC_NUMERIC=C
## [3] LC_TIME=en_US.UTF-8 LC_COLLATE=en_US.UTF-8
## [5] LC_MONETARY=en_US.UTF-8 LC_MESSAGES=en_US.UTF-8
## [7] LC_PAPER=en_US.UTF-8 LC_NAME=C
## [9] LC_ADDRESS=C LC_TELEPHONE=C
## [11] LC_MEASUREMENT=en_US.UTF-8 LC_IDENTIFICATION=C
##
## time zone: Etc/UTC
## tzcode source: system (glibc)
##
## attached base packages:
## [1] stats4 stats graphics grDevices utils datasets methods
## [8] base
##
## other attached packages:
## [1] ShortRead_1.69.4 GenomicAlignments_1.47.0
## [3] SummarizedExperiment_1.41.1 Biobase_2.71.0
## [5] MatrixGenerics_1.23.0 matrixStats_1.5.0
## [7] Rsamtools_2.27.2 GenomicRanges_1.63.2
## [9] Biostrings_2.79.5 Seqinfo_1.1.0
## [11] XVector_0.51.0 IRanges_2.45.0
## [13] S4Vectors_0.49.1 BiocParallel_1.45.0
## [15] BiocGenerics_0.57.1 generics_0.1.4
## [17] BiocStyle_2.39.0
##
## loaded via a namespace (and not attached):
## [1] sass_0.4.10 SparseArray_1.11.13 bitops_1.0-9
## [4] jpeg_0.1-11 lattice_0.22-9 digest_0.6.39
## [7] evaluate_1.0.5 grid_4.5.3 RColorBrewer_1.1-3
## [10] fastmap_1.2.0 jsonlite_2.0.0 Matrix_1.7-5
## [13] cigarillo_1.1.0 BiocManager_1.30.27 codetools_0.2-20
## [16] jquerylib_0.1.4 abind_1.4-8 cli_3.6.6
## [19] rlang_1.2.0 crayon_1.5.3 cachem_1.1.0
## [22] DelayedArray_0.37.1 yaml_2.3.12 S4Arrays_1.11.1
## [25] tools_4.5.3 parallel_4.5.3 deldir_2.0-4
## [28] interp_1.1-6 hwriter_1.3.2.1 png_0.1-9
## [31] buildtools_1.0.0 R6_2.6.1 lifecycle_1.0.5
## [34] pwalign_1.7.0 bslib_0.10.0 Rcpp_1.1.1
## [37] xfun_0.57 sys_3.4.3 knitr_1.51
## [40] latticeExtra_0.6-31 htmltools_0.5.9 rmarkdown_2.31
## [43] maketools_1.3.2 compiler_4.5.3