Rfastp 1.22.0
The Rfastp package provides an interface to the all-in-one preprocessing for FastQ files toolkit fastp(Chen et al. 2018).
Use the BiocManager package to download and install the package from
Bioconductor as follows:
if (!requireNamespace("BiocManager", quietly = TRUE))
install.packages("BiocManager")
BiocManager::install("Rfastp")
If required, the latest development version of the package can also be installed from GitHub.
BiocManager::install("remotes")
BiocManager::install("RockefellerUniversity/Rfastp")
Once the package is installed, load it into your R session:
library(Rfastp)
The package contains three example fastq files, corresponding to a single-end fastq file, a pair of paired-end fastq files.
se_read1 <- system.file("extdata","Fox3_Std_small.fq.gz",package="Rfastp")
pe_read1 <- system.file("extdata","reads1.fastq.gz",package="Rfastp")
pe_read2 <- system.file("extdata","reads2.fastq.gz",package="Rfastp")
outputPrefix <- tempfile(tmpdir = tempdir())
Rfastp support multiple threads, set threads number by parameter thread.
se_json_report <- rfastp(read1 = se_read1,
outputFastq = paste0(outputPrefix, "_se"), thread = 4)
pe_json_report <- rfastp(read1 = pe_read1, read2 = pe_read2,
outputFastq = paste0(outputPrefix, "_pe"))
pe_merge_json_report <- rfastp(read1 = pe_read1, read2 = pe_read2, merge = TRUE,
outputFastq = paste0(outputPrefix, '_unpaired'),
mergeOut = paste0(outputPrefix, "_merged.fastq.gz"))
umi_json_report <- rfastp(read1 = pe_read1, read2 = pe_read2,
outputFastq = paste0(outputPrefix, '_umi1'), umi = TRUE, umiLoc = "read1",
umiLength = 16)
the following example will add prefix string before the UMI sequence in the sequence name. An “_” will be added between the prefix string and UMI sequence. The UMI sequences will be inserted into the sequence name before the first space.
umi_json_report <- rfastp(read1 = pe_read1, read2 = pe_read2,
outputFastq = paste0(outputPrefix, '_umi2'), umi = TRUE, umiLoc = "read1",
umiLength = 16, umiPrefix = "#", umiNoConnection = TRUE,
umiIgnoreSeqNameSpace = TRUE)
Trim poor quality bases at 3’ end base by base with quality higher than 5; trim poor quality bases at 5’ end by a 29bp window with mean quality higher than 20; disable the polyG trimming, specify the adapter sequence for read1.
clipr_json_report <- rfastp(read1 = se_read1,
outputFastq = paste0(outputPrefix, '_clipr'),
disableTrimPolyG = TRUE,
cutLowQualFront = TRUE,
cutFrontWindowSize = 29,
cutFrontMeanQual = 20,
cutLowQualTail = TRUE,
cutTailWindowSize = 1,
cutTailMeanQual = 5,
minReadLength = 29,
adapterSequenceRead1 = 'GTGTCAGTCACTTCCAGCGG'
)
rfastq can accept multiple input files, and it will concatenate the input files into one and the run fastp.
pe001_read1 <- system.file("extdata","splited_001_R1.fastq.gz",
package="Rfastp")
pe002_read1 <- system.file("extdata","splited_002_R1.fastq.gz",
package="Rfastp")
pe003_read1 <- system.file("extdata","splited_003_R1.fastq.gz",
package="Rfastp")
pe004_read1 <- system.file("extdata","splited_004_R1.fastq.gz",
package="Rfastp")
inputfiles <- c(pe001_read1, pe002_read1, pe003_read1, pe004_read1)
cat_rjson_report <- rfastp(read1 = inputfiles,
outputFastq = paste0(outputPrefix, "_merged1"))
pe001_read2 <- system.file("extdata","splited_001_R2.fastq.gz",
package="Rfastp")
pe002_read2 <- system.file("extdata","splited_002_R2.fastq.gz",
package="Rfastp")
pe003_read2 <- system.file("extdata","splited_003_R2.fastq.gz",
package="Rfastp")
pe004_read2 <- system.file("extdata","splited_004_R2.fastq.gz",
package="Rfastp")
inputR2files <- c(pe001_read2, pe002_read2, pe003_read2, pe004_read2)
catfastq(output = paste0(outputPrefix,"_merged2_R2.fastq.gz"),
inputFiles = inputR2files)
dfsummary <- qcSummary(pe_json_report)
p1 <- curvePlot(se_json_report)
## Warning: `aes_string()` was deprecated in ggplot2 3.0.0.
## ℹ Please use tidy evaluation idioms with `aes()`.
## ℹ See also `vignette("ggplot2-in-packages")` for more information.
## ℹ The deprecated feature was likely used in the Rfastp package.
## Please report the issue to the authors.
## This warning is displayed once per session.
## Call `lifecycle::last_lifecycle_warnings()` to see where this warning was generated.
p1
p2 <- curvePlot(se_json_report, curve="content_curves")
p2
dfTrim <- trimSummary(pe_json_report)
usage of rfastp:
?rfastp
usage of catfastq:
?catfastq
usage of qcSummary:
?qcSummary
usage of trimSummary:
?trimSummary
usage of curvePlot:
?curvePlot
Thank you to Ji-Dung Luo for testing/vignette review/critical feedback, Doug Barrows for critical feedback/vignette review and Ziwei Liang for their support. # Session info
sessionInfo()
## R version 4.6.0 Patched (2026-04-24 r89963)
## Platform: aarch64-apple-darwin23
## Running under: macOS Tahoe 26.3.1
##
## Matrix products: default
## BLAS: /Library/Frameworks/R.framework/Versions/4.6/Resources/lib/libRblas.0.dylib
## LAPACK: /Library/Frameworks/R.framework/Versions/4.6/Resources/lib/libRlapack.dylib; LAPACK version 3.12.1
##
## locale:
## [1] C/en_US.UTF-8/en_US.UTF-8/C/en_US.UTF-8/en_US.UTF-8
##
## time zone: America/New_York
## tzcode source: internal
##
## attached base packages:
## [1] stats graphics grDevices utils datasets methods base
##
## other attached packages:
## [1] Rfastp_1.22.0 BiocStyle_2.40.0
##
## loaded via a namespace (and not attached):
## [1] gtable_0.3.6 jsonlite_2.0.0 rjson_0.2.23 dplyr_1.2.1
## [5] compiler_4.6.0 BiocManager_1.30.27 tinytex_0.59 tidyselect_1.2.1
## [9] Rcpp_1.1.1-1.1 stringr_1.6.0 magick_2.9.1 dichromat_2.0-0.1
## [13] jquerylib_0.1.4 scales_1.4.0 yaml_2.3.12 fastmap_1.2.0
## [17] plyr_1.8.9 ggplot2_4.0.3 R6_2.6.1 labeling_0.4.3
## [21] generics_0.1.4 knitr_1.51 tibble_3.3.1 bookdown_0.46
## [25] bslib_0.10.0 pillar_1.11.1 RColorBrewer_1.1-3 rlang_1.2.0
## [29] cachem_1.1.0 stringi_1.8.7 xfun_0.57 sass_0.4.10
## [33] S7_0.2.2 otel_0.2.0 cli_3.6.6 withr_3.0.2
## [37] magrittr_2.0.5 digest_0.6.39 grid_4.6.0 lifecycle_1.0.5
## [41] vctrs_0.7.3 evaluate_1.0.5 glue_1.8.1 farver_2.1.2
## [45] reshape2_1.4.5 rmarkdown_2.31 tools_4.6.0 pkgconfig_2.0.3
## [49] htmltools_0.5.9