Rfastp 1.18.0
The Rfastp package provides an interface to the all-in-one preprocessing for FastQ files toolkit fastp(Chen et al. 2018).
Use the BiocManager package to download and install the package from
Bioconductor as follows:
if (!requireNamespace("BiocManager", quietly = TRUE))
    install.packages("BiocManager")
BiocManager::install("Rfastp")If required, the latest development version of the package can also be installed from GitHub.
BiocManager::install("remotes")
BiocManager::install("RockefellerUniversity/Rfastp")Once the package is installed, load it into your R session:
library(Rfastp)The package contains three example fastq files, corresponding to a single-end fastq file, a pair of paired-end fastq files.
se_read1 <- system.file("extdata","Fox3_Std_small.fq.gz",package="Rfastp")
pe_read1 <- system.file("extdata","reads1.fastq.gz",package="Rfastp")
pe_read2 <- system.file("extdata","reads2.fastq.gz",package="Rfastp")
outputPrefix <- tempfile(tmpdir = tempdir())Rfastp support multiple threads, set threads number by parameter thread.
se_json_report <- rfastp(read1 = se_read1, 
    outputFastq = paste0(outputPrefix, "_se"), thread = 4)pe_json_report <- rfastp(read1 = pe_read1, read2 = pe_read2,
    outputFastq = paste0(outputPrefix, "_pe"))pe_merge_json_report <- rfastp(read1 = pe_read1, read2 = pe_read2, merge = TRUE,
    outputFastq = paste0(outputPrefix, '_unpaired'),
    mergeOut = paste0(outputPrefix, "_merged.fastq.gz"))umi_json_report <- rfastp(read1 = pe_read1, read2 = pe_read2, 
    outputFastq = paste0(outputPrefix, '_umi1'), umi = TRUE, umiLoc = "read1",
    umiLength = 16)the following example will add prefix string before the UMI sequence in the sequence name. An "_" will be added between the prefix string and UMI sequence. The UMI sequences will be inserted into the sequence name before the first space.
umi_json_report <- rfastp(read1 = pe_read1, read2 = pe_read2, 
    outputFastq = paste0(outputPrefix, '_umi2'), umi = TRUE, umiLoc = "read1",
    umiLength = 16, umiPrefix = "#", umiNoConnection = TRUE, 
    umiIgnoreSeqNameSpace = TRUE)Trim poor quality bases at 3’ end base by base with quality higher than 5; trim poor quality bases at 5’ end by a 29bp window with mean quality higher than 20; disable the polyG trimming, specify the adapter sequence for read1.
clipr_json_report <- rfastp(read1 = se_read1, 
    outputFastq = paste0(outputPrefix, '_clipr'),
    disableTrimPolyG = TRUE,
    cutLowQualFront = TRUE,
    cutFrontWindowSize = 29,
    cutFrontMeanQual = 20,
    cutLowQualTail = TRUE,
    cutTailWindowSize = 1,
    cutTailMeanQual = 5,
    minReadLength = 29,
    adapterSequenceRead1 = 'GTGTCAGTCACTTCCAGCGG'
)rfastq can accept multiple input files, and it will concatenate the input files into one and the run fastp.
pe001_read1 <- system.file("extdata","splited_001_R1.fastq.gz",
    package="Rfastp")
pe002_read1 <- system.file("extdata","splited_002_R1.fastq.gz",
    package="Rfastp")
pe003_read1 <- system.file("extdata","splited_003_R1.fastq.gz",
    package="Rfastp")
pe004_read1 <- system.file("extdata","splited_004_R1.fastq.gz",
    package="Rfastp")
inputfiles <- c(pe001_read1, pe002_read1, pe003_read1, pe004_read1)
cat_rjson_report <- rfastp(read1 = inputfiles, 
    outputFastq = paste0(outputPrefix, "_merged1"))pe001_read2 <- system.file("extdata","splited_001_R2.fastq.gz",
    package="Rfastp")
pe002_read2 <- system.file("extdata","splited_002_R2.fastq.gz",
    package="Rfastp")
pe003_read2 <- system.file("extdata","splited_003_R2.fastq.gz",
    package="Rfastp")
pe004_read2 <- system.file("extdata","splited_004_R2.fastq.gz",
    package="Rfastp")
inputR2files <- c(pe001_read2, pe002_read2, pe003_read2, pe004_read2)
catfastq(output = paste0(outputPrefix,"_merged2_R2.fastq.gz"), 
    inputFiles = inputR2files)dfsummary <- qcSummary(pe_json_report)p1 <- curvePlot(se_json_report)
p1p2 <- curvePlot(se_json_report, curve="content_curves")
p2dfTrim <- trimSummary(pe_json_report)usage of rfastp:
?rfastpusage of catfastq:
?catfastqusage of qcSummary:
?qcSummaryusage of trimSummary:
?trimSummaryusage of curvePlot:
?curvePlotThank you to Ji-Dung Luo for testing/vignette review/critical feedback, Doug Barrows for critical feedback/vignette review and Ziwei Liang for their support. # Session info
sessionInfo()## R version 4.5.0 RC (2025-04-04 r88126)
## Platform: x86_64-pc-linux-gnu
## Running under: Ubuntu 24.04.2 LTS
## 
## Matrix products: default
## BLAS:   /home/biocbuild/bbs-3.21-bioc/R/lib/libRblas.so 
## LAPACK: /usr/lib/x86_64-linux-gnu/lapack/liblapack.so.3.12.0  LAPACK version 3.12.0
## 
## locale:
##  [1] LC_CTYPE=en_US.UTF-8       LC_NUMERIC=C               LC_TIME=en_GB             
##  [4] LC_COLLATE=C               LC_MONETARY=en_US.UTF-8    LC_MESSAGES=en_US.UTF-8   
##  [7] LC_PAPER=en_US.UTF-8       LC_NAME=C                  LC_ADDRESS=C              
## [10] LC_TELEPHONE=C             LC_MEASUREMENT=en_US.UTF-8 LC_IDENTIFICATION=C       
## 
## time zone: America/New_York
## tzcode source: system (glibc)
## 
## attached base packages:
## [1] stats     graphics  grDevices utils     datasets  methods   base     
## 
## other attached packages:
## [1] Rfastp_1.18.0    BiocStyle_2.36.0
## 
## loaded via a namespace (and not attached):
##  [1] gtable_0.3.6        jsonlite_2.0.0      dplyr_1.1.4         compiler_4.5.0     
##  [5] BiocManager_1.30.25 rjson_0.2.23        tinytex_0.57        tidyselect_1.2.1   
##  [9] Rcpp_1.0.14         stringr_1.5.1       magick_2.8.6        jquerylib_0.1.4    
## [13] scales_1.3.0        yaml_2.3.10         fastmap_1.2.0       ggplot2_3.5.2      
## [17] R6_2.6.1            plyr_1.8.9          labeling_0.4.3      generics_0.1.3     
## [21] knitr_1.50          tibble_3.2.1        bookdown_0.43       munsell_0.5.1      
## [25] bslib_0.9.0         pillar_1.10.2       rlang_1.1.6         cachem_1.1.0       
## [29] stringi_1.8.7       xfun_0.52           sass_0.4.10         cli_3.6.4          
## [33] withr_3.0.2         magrittr_2.0.3      digest_0.6.37       grid_4.5.0         
## [37] lifecycle_1.0.4     vctrs_0.6.5         evaluate_1.0.3      glue_1.8.0         
## [41] farver_2.1.2        colorspace_2.1-1    reshape2_1.4.4      rmarkdown_2.29     
## [45] tools_4.5.0         pkgconfig_2.0.3     htmltools_0.5.8.1Chen, Shifu, Yanqing Zhou, Yaru Chen, and Jia Gu. 2018. “fastp: an ultra-fast all-in-one FASTQ preprocessor.” Bioinformatics 34 (17): i884–i890. https://doi.org/10.1093/bioinformatics/bty560.