writeDotBracket {ncRNAtools} | R Documentation |
Writes a file with the sequence and secondary structure of an RNA in the Dot-Bracket format.
writeDotBracket(filename, sequence, secondaryStructure, sequenceName="Sequence")
filename |
A string indicating the path to the Dot-Bracket file to be written. A description of the Dot-Bracket format can be found at https://www.tbi.univie.ac.at/RNA/ViennaRNA/doc/html/rna_structure_notations.html. The resulting file will contain three lines. The first line starts with ">", after which the name of the sequence follows. The second line contains the RNA sequence. The third line contains the secondary structure representation in Dot-Bracket notation. |
sequence |
A string with the full-length sequence of the RNA for which a Dot-Bracket file should be written. |
secondaryStructure |
A string representing the secondary structure of the RNA sequence in the Dot-Bracket format. |
sequenceName |
A string with the name of the RNA sequence for which a Dot-Bracket file should be written. |
Called for its effect of writing a Dot-Bracket file. Invisibly returns the status code returned by close when closing the file connection. See documentation of close for details.
https://software.broadinstitute.org/software/igv/RNAsecStructure
http://projects.binf.ku.dk/pgardner/bralibase/RNAformats.html
# Write a Dot-Bracket file by providing an RNA sequence and its secondary structure in # the Dot-Bracket format: tempDir <- tempdir() DotBracketFile <- paste(tempDir, "testDotBracketFile.dot", sep="") writeDotBracket(DotBracketFile, "AGCGGGUUCCUGGUUCCCCAAGGUUGA", secondaryStructure="...(((..((.))..))).((..))..", sequenceName="Test sequence")